Erratum: Oncogenic Role of Fusion-circRNAs Derived from Cancer-Associated Chromosomal Translocations (Cell (2016) 165(2) (289–302))

Jlenia Guarnerio, Marco Bezzi, Jong Cheol Jeong, Stella V. Paffenholz, Kelsey Berry, Matteo M. Naldini, Francesco Lo-Coco, Yvonne Tay, Andrew H. Beck, Pier Paolo Pandolfi

Research output: Contribution to journalComment/debatepeer-review

Abstract

(Cell 165, 289–302; April 7, 2016) In the above article, which identifies circular RNAs derived from cancer-associated chromosomal translocations and shows their tumor-promoting properties, there is a duplicated plot panel in Figure 5. This figure analyzes the role of the endogenous circular RNA f-circM9 in the maintenance of cancer cells. In panel 5G, which demonstrates that the knockdown of the endogenous f-circM9s in THP1 cells affects their survival, the plot showing the number of cells undergoing apoptosis upon treatment with shCircPR1 has been inadvertently replaced with the plot belonging to the cells treated with the shSCR shRNA. The quantitation shown in the chart in Figure 5G is correct, as it refers to the correct plot. The oversight on the plot panel was encountered only during assembly of the final panel of the figure. The panel has been corrected online and appears below; it supports the original conclusions that shCircPR1 does not affect the survival of the THP1 cells. In addition, the sequence of the primers spanning the junction of the circM9_1, listed in Table S4, was determined to be incorrect. The correct primers are: Fw: CCAGGCAACAAGCTGTGAAAA; Rv: CTCTTTTCCTCGACGGGCTT. Table S4 has also been corrected online, and we apologize for any confusion that these errors may have caused.

Original languageEnglish
Pages (from-to)1055-1056
Number of pages2
JournalCell
Volume166
Issue number4
DOIs
Publication statusPublished - Aug 11 2016

ASJC Scopus subject areas

  • Medicine(all)
  • Biochemistry, Genetics and Molecular Biology(all)

Fingerprint

Dive into the research topics of 'Erratum: Oncogenic Role of Fusion-circRNAs Derived from Cancer-Associated Chromosomal Translocations (Cell (2016) 165(2) (289–302))'. Together they form a unique fingerprint.

Cite this