Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

Martin Hennenberg, Frank Strittmatter, Christer Beckmann, Beata Rutz, Claudius Füllhase, Raphaela Waidelich, Francesco Montorsi, Petter Hedlund, Karl Erik Andersson, Christian G. Stief, Christian Gratzke

Research output: Contribution to journalArticle

7 Citations (Scopus)

Abstract

Background: The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective: To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods: Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results: Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 μM) or NA (30 μM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 μM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions: Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.

Original languageEnglish
Article numbere50904
JournalPLoS One
Volume7
Issue number11
DOIs
Publication statusPublished - Nov 30 2012

Fingerprint

ets-Domain Protein Elk-1
Serum Response Factor
norepinephrine
smooth muscle
Smooth Muscle
Muscle
Prostate
Norepinephrine
transcription factors
adrenergic receptors
Chemical activation
phosphorylation
nucleotide sequences
serine
Phosphorylation
Tissue
DNA sequences
Western blotting
Adrenergic Receptors
Electrophoretic mobility

ASJC Scopus subject areas

  • Agricultural and Biological Sciences(all)
  • Biochemistry, Genetics and Molecular Biology(all)
  • Medicine(all)

Cite this

Hennenberg, M., Strittmatter, F., Beckmann, C., Rutz, B., Füllhase, C., Waidelich, R., ... Gratzke, C. (2012). Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle. PLoS One, 7(11), [e50904]. https://doi.org/10.1371/journal.pone.0050904

Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle. / Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl Erik; Stief, Christian G.; Gratzke, Christian.

In: PLoS One, Vol. 7, No. 11, e50904, 30.11.2012.

Research output: Contribution to journalArticle

Hennenberg, M, Strittmatter, F, Beckmann, C, Rutz, B, Füllhase, C, Waidelich, R, Montorsi, F, Hedlund, P, Andersson, KE, Stief, CG & Gratzke, C 2012, 'Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle', PLoS One, vol. 7, no. 11, e50904. https://doi.org/10.1371/journal.pone.0050904
Hennenberg M, Strittmatter F, Beckmann C, Rutz B, Füllhase C, Waidelich R et al. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle. PLoS One. 2012 Nov 30;7(11). e50904. https://doi.org/10.1371/journal.pone.0050904
Hennenberg, Martin ; Strittmatter, Frank ; Beckmann, Christer ; Rutz, Beata ; Füllhase, Claudius ; Waidelich, Raphaela ; Montorsi, Francesco ; Hedlund, Petter ; Andersson, Karl Erik ; Stief, Christian G. ; Gratzke, Christian. / Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle. In: PLoS One. 2012 ; Vol. 7, No. 11.
@article{3e6a6055173443d1ac2f0b13f4bac652,
title = "Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle",
abstract = "Background: The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective: To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods: Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results: Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 μM) or NA (30 μM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 μM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions: Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.",
author = "Martin Hennenberg and Frank Strittmatter and Christer Beckmann and Beata Rutz and Claudius F{\"u}llhase and Raphaela Waidelich and Francesco Montorsi and Petter Hedlund and Andersson, {Karl Erik} and Stief, {Christian G.} and Christian Gratzke",
year = "2012",
month = "11",
day = "30",
doi = "10.1371/journal.pone.0050904",
language = "English",
volume = "7",
journal = "PLoS One",
issn = "1932-6203",
publisher = "Public Library of Science",
number = "11",

}

TY - JOUR

T1 - Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

AU - Hennenberg, Martin

AU - Strittmatter, Frank

AU - Beckmann, Christer

AU - Rutz, Beata

AU - Füllhase, Claudius

AU - Waidelich, Raphaela

AU - Montorsi, Francesco

AU - Hedlund, Petter

AU - Andersson, Karl Erik

AU - Stief, Christian G.

AU - Gratzke, Christian

PY - 2012/11/30

Y1 - 2012/11/30

N2 - Background: The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective: To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods: Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results: Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 μM) or NA (30 μM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 μM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions: Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.

AB - Background: The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective: To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods: Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results: Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 μM) or NA (30 μM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 μM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions: Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.

UR - http://www.scopus.com/inward/record.url?scp=84870578833&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=84870578833&partnerID=8YFLogxK

U2 - 10.1371/journal.pone.0050904

DO - 10.1371/journal.pone.0050904

M3 - Article

VL - 7

JO - PLoS One

JF - PLoS One

SN - 1932-6203

IS - 11

M1 - e50904

ER -